Rapid communication: the ovine cDNA encoding interferon-stimulated gene product 17 (ISG17).
نویسندگان
چکیده
Name of the Sequence. Ovine interferon-stimulated gene product 17 (oISG17). Genus and Species, Breed. Ovis aries, Purebred Romanov and Hampshire, crossbred Columbia × Rambouillet and Romanov × Hampshire. Origin of the Clone. Ovine endometrial RNA was pooled from nonpregnant and pregnant ewes (d 7, 8, and 10 nonpregnant; d 13, 15, and 16 pregnant and nonpregnant; and d 21 pregnant) and used to make a cDNA library that was cloned into a HybriZAP 2.1 twohybrid vector system (Stratagene, LaJolla, CA). Insert size ranged from .4 to 1.7 kb, with an average size of .9 kb. Bovine (b)ISG17 cDNA (Austin et al., 1996a) was radiolabeled (α-labeled 32P-dCTP, ≥ 3,000 Ci/mmol, Amersham Pharmacia Biotech, Piscataway, NJ) using a random prime reaction (Life Tech, Grand Island, NY). Phage from the ovine endometrial cDNA library were screened with radiolabeled bISG17 cDNA using standard procedures (Austin et al., 1996a). Positive plaques were isolated using autoradiography and then purified. Two positive clones were excised from phage and cDNA inserts were sequenced using ABI Prism dRhodamine Terminator Cycle Sequencing Ready Reaction procedures (Applied Biosystems, Foster City, CA). Cycle sequencing was performed using an Ericomp thermocycler (San Diego, CA) and the following conditions for 25 cycles: 96°C for 30 s, 50°C for 30 s, and 60°C for 4 min. Sequence Data. Both 614-bp oISG17 cDNA were identical. The ISG17 cDNA clone AC100A is shown in Figure 1 (EMBL/GenBank accession no. AF152103). Comparison with Related Sequences. The oISG17 cDNA sequence had 94% identity with the bISG17 cDNA (U96014) and exons 1 and 2 of the bISG17 gene (AF069133; Perry et al., 1999). It also shared 81% identity to human (h) ISG15 (M13755) and 80% identity with mouse (m) ISG15 (X56602) cDNA.
منابع مشابه
Cloning of interferon-stimulated gene 17: the promoter and nuclear proteins that regulate transcription.
A member of the interferon-stimulated gene (ISG) family encodes a 17-kDa ubiquitin homolog called ISG17 that is induced in the bovine uterine endometrium by interferon-tau (IFN-tau) during early pregnancy. The bovine (b) ISG17 cDNA shares 30% identity with a tandem ubiquitin repeat and 70% identity with human (h) ISG15. The present experiments were designed to sequence the bISG17 gene, compare ...
متن کاملRapid communication: nucleotide sequence of the river buffalo beta-casein cDNA.
Name of the Sequence. River buffalo kappa-casein cDNA. Genus and Species. Bubalus arnee bubalis. Origin of the Clone. Ten micrograms of total RNA from mammary tissue of lactating buffalo was reverse-transcribed using an oligo d(T)17 primer and superscript II reverse transcriptase (GIBCO-BRL, Grand Island, NY). The forward primer (5′GTGACAAGGAAAGGTGCAATG3′) was designed from conserved regions, t...
متن کاملOvine interferon-γ gene of indigenous sheep: Cloning, sequencing and expression studies in Escherichia coli
Ovine interferon-gamma (IFN-γ) cDNA was isolated from total mRNA of peripheral blood mononuclear cells from indigenous sheep by reverse transcription PCR. The cDNA was successfully cloned, sequenced and expressed in Escherichia coli as thioredoxin fusion protein. Sequence comparison of Indian sheep IFN-γ showed high nucleotide homology with published IFN-γ sequences of sheep and other species o...
متن کاملA COMPARATIVE STUDY BETWEEN EXPRESSION OF A SYNTHETIC GENE OF HUMAN BASIC FIBROBLAST GROWTH FACTOR (hbFGF) AND ITS RELATED cDNA IN ESCHERICHIA COLI
The gene encoding the human basic fibroblast growth factor (hbFGF) has been already chemically-synthesized and cloned in pET-3a expression vector (Pasteur Institute of Iran). In the present study, we compared the level of expression of this synthetic hbFGF and its related cDNA in Escherichia coli. The pBR322-cDNA of hbFGF supplied by Dr. Seno (from Molecular Biology Dept, Okaido prefectural uni...
متن کاملRapid communication: a restriction fragment length polymorphism in the ovine Prolactin gene.
Polymorphism. A HaeIII PCR-RFLP was identified in the ovine prolactin ( PRL) gene. Source and Description of Primers. Human genomic (Truong et al., 1984) and pig cDNA (GenBank accession no. X14068) sequences were compared to design primers to span the second intron of the prolactin gene.
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Journal of animal science
دوره 78 5 شماره
صفحات -
تاریخ انتشار 2000